Change Successful
If you are reading this message, then you are viewing my website on its new webhost. Hopefully there will be better performance here at www.pair.com. If you experience any problems leaving comments, notice things that are missing, such as pictures, or find any broken links, let me know so I can fix them. Thanks and enjoy the faster site!
Loading ...
Jun 19th, 2004 at 12:14:00
Lots of broken links and missing graphics.
Jun 19th, 2004 at 12:44:46
Congrats on the successful move!
Jun 19th, 2004 at 15:48:22
domain resolution did not work; had to guess IP addresses until I found the correct one.
Should seek to remedy this.
Jun 19th, 2004 at 20:49:10
Your headline link at the top of your page… “Chris Vaught.com” But I guess that was obvious…
–Bryan “Elwood Blues” R.
Jun 20th, 2004 at 03:00:04
Hmm, so I guess the change wasn’t as successfully as I thought… I’ve fixed a couple things tonight, but the pictures are gonna be broken for a while until I can figure out what the deal with that is…
Jun 20th, 2004 at 03:14:24
Ok, so I lied…couldn’t wait until morning to fix the pics. Got the problem fixed, so the picture gallery should be back online now.
As far as I can tell, all the images and links should be fixed now. If you find anything that’s broken, please let me know. Thanks!
Jun 20th, 2004 at 03:56:31
Okay, seems like there is still a problem with the comments here…Seems that it won’t remember your personal information, even if the “yes” button above it checked. Can someone else confirm that they have the same problem…? I thought it involved cookies, but apparently there something internally that’s wrong..
Jun 20th, 2004 at 09:18:41
Confirming that it doesnt remember personal info on comments. Good Luck!
Jun 20th, 2004 at 09:35:21
Twice confirmed.
Jun 20th, 2004 at 10:41:39
Wow, Chris. On your website at 3AM? I guess that’s true dedication or just plain craziness! :o)
Jun 20th, 2004 at 21:46:40
Well, I didn’t really go and “test” out too much of your site, but I did notice that if I click on someone’s name within this comment field it opens their page up in this little dialoge window. I’m thinking that’s not how it’s supposed to work. If it is how you intended it to work, I think you should change it.
Also as I read your comments I realized that no matter how much I deny being a computer person, there’s still a little bit of me that is b/c I understand your (plural) craziness. I guess it’s true that “Birds of a feather stick together.” I just can’t get away! Not that I want to. I love you all, I just deny being a “computer person.” Maybe it’s because next to all of you I’m not a good one so I’d rather just not be one than to not be good at it. Ok this is getting to deep for me right now. I have a paper to write.
Jun 20th, 2004 at 22:04:19
Anyone that figures out how to mooch off the neighboring church’s wireless network, is a computer person.
Jun 20th, 2004 at 22:49:17
Jeff, you are correct there. And not only are they a computer person but a pretty intellgible computer person at that.
So sorry Ashlee, you cant deny being part of the “Computer Community”. Nice try though.
Jun 20th, 2004 at 23:52:07
Ashlee, I’m not sure if the issue regarding clicking on the name was around before or not, but I agree it should be changed. Unfortunately, it doesn’t look like the software that I’m using for my blog will allow me to change that… I’ve looked into fixing it, but can’t find the right place in the code to change yet. Oh, and as much as you may deny, you are a computer person
There’s no escaping!
Jun 21st, 2004 at 00:04:32
4$h133 = 1337h4×0r
Jun 21st, 2004 at 07:54:57
lol, nice nick
Jun 21st, 2004 at 10:06:36
See I don’t think I know what Nick’s post means so I’m not a real computer person! Ha!!
Jun 21st, 2004 at 13:00:29
Clever girl.
And she plays dumb…
Jun 21st, 2004 at 13:23:47
okay, “remember personal info” should be working again!
and just in case you’ve forgotten how to understand computer speak, Ashlee, here are some links to refresh your memory.
http://www.blackcoffee.org.uk/l33t.shtml
http://www.ryanross.net/leet/
Be sure to try a google search, too:
http://www.google.com/intl/xx-hacker/
Jun 21st, 2004 at 13:24:39
Oh, and while it seems that relationships generate a lot of comments, apparently breaking your website does too
Jun 21st, 2004 at 13:27:54
The window size and clicking on names has been an issue for a while. If Chris was a REALLY GOOD computer person, he’d get it fixed.
Jun 21st, 2004 at 13:28:23
Ashlee, maybe you can help him with it.
Jun 21st, 2004 at 13:31:29
If anyone knows perl code pretty well, then by all means, help me out! I program in perl all day long, and it’s my favorite language, and I can’t find the stupid place where it generates those links.
I thought I got the window size thing fixed, though, so that you can at least resize the window when a website opens up in it. Is that broken again? Seems to allowing resizing for me…
Jun 21st, 2004 at 18:27:52
Since I am not a h4×0r or a Doom player (Ok, I know Chris will know better- I have played it before, but I’m not a serious Doom player) so why would I have any reason to say I’m 1337 ?
Sorry I don’t know anything about perl. Is there no way to set the target?
I don’t know whether to be flattered or annoyed that you all *think* I’m a computer person. I’m still deciding. Being the decisive person I am you have time to pursuade me. haha
Jun 21st, 2004 at 18:56:40
Wow…so much happens in a day when I am at work and asleep. I thought I went to bed late last night apparently not.
R does not understand N
A does not understand N
R is a computer person
Therefore N does not determine a computer person.
Therefore A can still be a computer person.
Thats all she wrote!
Jun 21st, 2004 at 19:11:03
Ashlee, you may not have been much of a Doom player, but I know you loved playing Dune, and I seem to remember at least one try at Starcraft. Hmm, I think Centipede was part of your game phase too…
Um, Robin, that’s quite a formula you thought up there. I think we can all safely and definitely call you a geek!
Jun 21st, 2004 at 21:58:24
Yeah I think I bought Dune but I have no idea where it would be these days. My “game playing” stage was very short. But none-the-less it happened.
I agree Robin is definitely a geek!
Jun 21st, 2004 at 23:02:57
All that shows is that Robin was doing her Logic homework while Nick was playing Counter-Strike!!!
Jun 21st, 2004 at 23:05:41
I spent some time doing Perl. But if you program in Perl all day and you can’t spot it I probably won’t be able to spot it either. Then again, coming with a fresh set of eyes may make it easy to spot. (I’ve had that experience quite a bit in searching for bugs!)
But Perl can be written in such an obfuscated fashion that no one including the original author might be able to find the place where those links are generated.
Jun 21st, 2004 at 23:06:38
If I were to be making suggestions, I would wonder if you couldn’t put a border around each comment or something — do something to make one set apart from another more. With the uniform background and no border around, they kind of run together I think.
Jun 21st, 2004 at 23:33:46
Hmm, yeah, I can probably do the border thing. The problem with the name link is that the link calls a cgi program, which includes a perl module, which includes another perl module, so I have to wade through the obfuscated code (why doesn’t anyone leave comments in their code anymore!) and look for a certain variable and change how the link is created there. Haven’t given up yet, though.
Jun 21st, 2004 at 23:45:14
Thanks Nick!
Chris, glad that you liked my formula and that it actually made sense.
Jun 21st, 2004 at 23:52:39
Lol, who ever said it makes sense!
Jun 21st, 2004 at 23:57:21
Since you didnt try to correct the logic in the formula or at least comment on its potential flaws, I would say it had to make some sort of sense. I know that if you could find a flaw, you would have definitely pointed it out to me
Jun 22nd, 2004 at 19:52:34
How do the comments look now, Nick? Better?
I welcome any additional suggestions if anyone has any.
Jun 22nd, 2004 at 20:26:17
I like the boxes… Could you make my comments red so that when I come back to read the new posts I can look for my red comments and then just read below it to see what’s new? That would shorten my hours of blogging by about 5 minutes… hehehe
Jun 23rd, 2004 at 16:01:04
This is really sparking a lot of comments, if only I knew really what was going on. Chris you definately got all the computer genes.
Jun 23rd, 2004 at 16:21:27
Lol, the one that supposedly got the computer genes ended up breaking his own website, causing all the comments
Some people talk about relationships and get tons of comments. I break my site, and the people come running.
Jun 23rd, 2004 at 17:46:25
I had the problem with remembering personal info.
–Bryan “Elwood Blues” R.
Jun 23rd, 2004 at 19:30:31
I like the boxes. If you can just figure out the Name link thing, then you’d really have an impressive site.
Jun 24th, 2004 at 11:52:48
I agree with Jeff. But really I don’t use the name links so much anyway, but for people who might be “new” they might want to know who your commenters are.
I’m still waiting to see what you have up your sleeve Chris!
Jun 24th, 2004 at 12:33:55
I think the new challenge should be to get 100 comments in this one posting. We can’t let a silly relationship post outdo a computer tech post… not with all these computer people!
Jun 24th, 2004 at 13:05:01
Amen, Jeff! 43 and counting…
Still looking for the section of code that I need to adjust for the name links. Maybe I’ll be able to get it fixed by this weekend. The code is actually commented quite well, but since there are so many different modules scattered out in different directories, it’s been hard to chase variables and such from one file to another.
Jun 24th, 2004 at 15:03:04
lol, seems Ashlee has learned to speak l33t after all! Just look at her comments
Jun 24th, 2004 at 16:27:49
Since I can’t speak in computer terms and get all this computer stuff, I’ll use my biology genes, referred to earlier by my brother, to carry on a conversation. There is only one problem, I have 4 letters to use if we are talking DNA, 5 if I include RNA. aaggtcttcgatcgctatataaaagggccatatatatatccctgtctcgtatgctcgatcggctagctttttaaaaatttcccgttt
Jun 24th, 2004 at 16:41:08
David,
If you want to type and look like you’re talking 133+ like me, just type my name in the info and that should do it… then again I’ll have to do some testing.
Jun 24th, 2004 at 16:42:25
Yup it’s all in the name. So type Ashlee as your name and you’ll get this cool language.
Chris, you have to count my Ashlee* toward my coun+!!
Jun 24th, 2004 at 16:43:47
Yup I tested changing other data. THe name is the key. So there’s you a way to look cool. Anyone out there who want to translate a message into leet, just type my name and comment what you want to translate on Chris’s page. While you’re at it you can help me win the prize! haha
Jun 24th, 2004 at 16:59:10
Lol, you’re having some fun with this huh? I could have used either the name or an ip address, but you had several IPs associated with your comments, so I went the easy route. Don’t worry, I’ll turn off the l33t talk after a day or so and the comments will all turn back to normal.
Jun 24th, 2004 at 17:09:50
I think I went a *little* overboard on the l33t speak, so I turned it down some…
Jun 24th, 2004 at 17:32:03
The boxes look good, Chris. Easier to read and scan anyway.
Jun 24th, 2004 at 22:38:05
Totally agree with you Jeff. Tech post should outdo a relationship post any day of the week. Though I sometimes try to stay away from Tech stuff away from work. Hopefully that will change soon.
Jun 26th, 2004 at 19:25:13
Quite flooding Chris with problems! geez! lol
–Bryan “Elwood Blues” R.